Skip to content

Latest commit

 

History

History
83 lines (77 loc) · 3.76 KB

README.md

File metadata and controls

83 lines (77 loc) · 3.76 KB
Raw

This repository contains all the variants of BlockTrees described in the experimental study available here. If you are looking for the cannonical version used in the journal article, which is also more reusable and uses less contruction space, you can go to https://github.com/elarielcl/MinimalistBlockTrees/

Description

This repository contains an implementation for the BlockTree data structure described here. In addition to the paper's proposal, this code contains some improvements, and heuristics to play with.

Installation Guide

First clone the repo with its submodule:

 git clone --recurse-submodules https://github.com/elarielcl/BlockTrees.git

This project uses the sdsl library, so previous to compile it you should install the sdsl. To install it:

cd BlockTrees/external/sdsl-lite
./install.sh .

This project is a CMake project. To build this project with some runnables you should do

cd ../..
mkdir build
cd build
cmake ..
make

You can add an executable by writing your file in the executables directory and add its name to the executables/CMakeLists.txt file, this adds the necessary libraries for you:

set(project_EXECUTABLES
        <new_executable>
        main
        padding_main
        inputs
        experiments_block_tree
        experiments_padding_block_tree)
...

Usage Guide

This code contains some examples of executables from where you can see the different versions of BlockTrees and constructions implemented.

Example

Let's suppose we want to build a BlockTree following the ideas on its original paper, so we do:

...
std::string input = "AACCCTGCTGCTGATCGGATCGTAGC";
int r = 2; //The arity of the BlockTree
int mll = 16; // The max length that a BlockTree's leaf could represent

BlockTree* bt = new BlockTree(input, r, mll); // This creates the BlockTree object
bt->process_back_pointers(); // This method builds the BackPointers in the BlockTree
bt->clean_unnecessary_expansions(); // This method removes the expansion of InternalBlocks that are unnecesary (this is an state-of-the-art space improvement, also called pruning)
 ...

in case you want to build the heuristic_bt version instead you can replace the last two lines with

bt->process_back_pointers_heuristic();

.. now you have a proper BlockTree answering access queries(bt->access(i)), if you want to give it bt->rank(c,i) & bt->select(c,j) support you should do:

for (int c: characters)
    bt->add_rank_select_support(c);

So the above is a pointer-based implementation of BlockTrees, if you want to have a more compact representation (using bitvectors to represent the tree) you should do:

...
CBlockTree *cbt = new CBlockTree(bt); // Builds a more compact BlockTree representation
cbt->access(i);
cbt->select(c,i);
cbt->print_statistics(); // It prints the space used for the different components of the tree
...

... and never forget to delet your trash ;)

...
delete bt;
delete cbt;
...

Additional

  • You can change BlockTree to PBlockTree and CBlockTree to PCBlockTree and get a faster and even more compact version of the tree (it uses padding in the input sequence).
  • There are other implementations of rank & selectas well as implementation using compressed int/bitvectors
  • There are many others constructions which are heuristics as well as constructions using a string with a bigger alphabet (std::basic_string<int64_t>)

Contact

Any error, improvement or suggestion you can write me to elarielcl in Gmail.