With different read name, the algnment results seem different

[TomhitsJerry]

I use a totally the same fq, with the same sequence and quality, but only the read name differ. And got a different algnment result, here is one example of a read:

As you see, two reads with the same sequence and quality:
CCACAAAATAATAACAGCCATCTATGACAGACCCACAGCCAACATCATACAGAATGGGGAAAAATTGGAGGCATA
EEEEEEEEEEEEEEEEEEEEE@EEEEEEEEEEEEEEE@EEEEEEEEEEEEEEEEEEEEEEEEEEEEE@6EEEEEE..............................
but only with different read name:
2305151010:9:2D240611017US2S2720DX:L00:R001C020:2179:0810
202408121835_2305151010_2D240611017US2S2720DX_B_20240812B86L00R001C020:21790810:9
while have different results:
the first one is mapped:2305151010:9:2D240611017US2S2720DX:L00:R001C020:2179:0810
the second is unmap: 202408121835_2305151010_2D240611017US2S2720DX_B_20240812B86L00R001C020:21790810:9
the version of bowtie2 I used is 2.5.1, I cant see any update or changes about read name from the newly versions, and maybe the new version may have same siuation too.
Looking forward to it, thanks!

[mcolpus]

I think this is actually expected. If you look in the docs: https://bowtie-bio.sourceforge.net/bowtie2/manual.shtml under "Randomness in Bowtie 2" it says that the random number generator is effected by read name