Formatting dipcall vcf to use in truvari

[mchaisso]

Hi Adam,
I need to format a dipcall vcf for use in truvari. The output of dipcall is follows:
chr1 181157 . ggcgcagagaggcgcgccgcgccggcgcaggcgcagagaggcgcgccgcgccggcgcaggcgcagagaggcgcgcctcgccggcgcaggcgcagagaggcgcgccgggccggcgcaggcgcagagaggc G 30 . . GT:AD 1|1:0,2

This has problems: missing SVLEN, and has multiallelic calls. I added SVLEN based on the first alt allele length, and made the multiallelic genotypes reference only 0 or 1 genotypes, but there may be a problem still. When I perform benchmarking, nearly identical calls (insertions) between the bench and compare are showing up as fp's.

Thanks in advance,
-Mark

[ACEnglish]

Hello,

Truvari doesn't handle multi-allelic VCFs (wiki). If you're using version 4.0+ they should raise an error and exit early. To fix this, simply run bcftools norm -m-any. Given that you're using dipcall, and presumably have haplotype information, you may also want to prevent norm from maybe destroying that haplotype information with -N/--do-not-normalize.
Also, since you'll be splitting the records, you may be interested in using --pick ac (details)

For the INFO fields you'd like to add, simply run truvari anno svinfo which adds SVTYPE and SVLEN INFO fields (details).

Please let me know if this fixes your problems or you have more questions.

Have a great day,
~/Adam English